DNA Phylogeny

Create phylogenetic trees using DNA! Either paste/upload your own JSON-formatted DNA sequences or create random trees! (Note: The algorithm used to compare genetic differences is not perfect, so pyhlogenetic trees might not be 100% correct)

Generate Random Tree Use Sample JSON Paste JSON text
Upload JSON/text file:
The canvas doesn't work in your browser!

Submitting DNA

Files can be any type, but the text inside must be written in JSON format creating an array with each species as an object inside it. Each species object has a name attritube with the name of the species and a DNA attribute with the genetic code.

Example:

    [
        {"name":"Canis familiaris", "DNA":"ACGTGCGAGACTCGCAAGG"},
        {"name":"Canis Lupus", "DNA":"TATGCGATTACTCGTTAAGG"},
        {"name":"Felis Catus", "DNA":"GGGTTTTGCGAACGGACTT"}
    ]